Abstract
Using RT-PCR (Reverse Transcriptase Polymerase Chain Reaction), the oxytocin receptor CDNA between transmembrane domain IV and V region was cloned from ovine endometrium at Day 16 of the estrous cycle. Obtained sequence showed 98% identity and 97% homology with the human CDNA at nucleic acids and amino acids levels, respectively. Within the transmembrane domain IV, an amino acid, histidine (at position 172 of the human oxytocin receptor), was changed to asparagine in sheep. Sequences of the primer pair used in this study were followed: (51 or forward primer) gcgtccagcacacgatgaaggc and (31 or reverse primer) cagctagcgtgatccat. Using this obtained clone as a probe, the expression of the oxytocin receptor gene in uterine endometrium was examined by RTPCR-Southern analysis from different stages of the estrous cycle (Days 0, 8, 13) and early pregnancy (Day 11 of pregnancy). All the samples examined showed the presence of MRNA for oxytocin receptor. This study facilitated the further analyses including quantification and rate of turnover of MRNA, which are required to understand the direct interactions between the oxytocin receptor and other hormones such as ovarian steroids and/or interferon-tau (INF-r).
Suzuki, Makiko (1994). Molecular cloning of the complementary DNA and expression of the endometrial oxytocin receptor during early pregnancy in ewes. Master's thesis, Texas A&M University. Available electronically from
https : / /hdl .handle .net /1969 .1 /ETD -TAMU -1994 -THESIS -S9686.